Creation: The Origin of Life / The Future of Life (Paperback)
  • Creation: The Origin of Life / The Future of Life (Paperback)
zoom

Creation: The Origin of Life / The Future of Life (Paperback)

(author)
5 Reviews Sign in to write a review
£9.99
Paperback 272 Pages / Published: 06/02/2014
  • In stock online

Usually dispatched within 24 hours

  • This item has been added to your basket
Your local Waterstones may have stock of this item. Please check by using Click & Collect

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Publisher: Penguin Books Ltd
ISBN: 9780241954690
Number of pages: 272
Weight: 254 g
Dimensions: 198 x 129 x 19 mm


MEDIA REVIEWS
Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller * Mail on Sunday *
One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet * Observer *
Fascinating. The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny * Sunday Telegraph *
The perfect primer on the past and future of DNA * Guardian *

You may also be interested in...

Bad Science
Added to basket
£9.99   £8.49
Paperback
The Quantum Universe
Added to basket
£9.99
Paperback
Sapiens
Added to basket
£10.99   £8.99
Paperback
The Knowledge
Added to basket
£9.99
Paperback
The Grand Design
Added to basket
You Are the Placebo
Added to basket
£12.99
Paperback
In Search Of Schrodinger's Cat
Added to basket
£9.99   £7.99
Paperback
Cosmos
Added to basket
£12.99
Paperback
The Things that Nobody Knows
Added to basket
The Brain That Changes Itself
Added to basket
A Little History of Science
Added to basket
Zero Degrees of Empathy
Added to basket
How to Teach Quantum Physics to Your Dog
Added to basket
The Sports Gene
Added to basket
£9.99
Paperback

“A Brief Summary and Review”

*A full executive summary of this book will be available at newbooksinbrief dot com, on or before Tuesday, July 9, 2013.

As the blueprint of all that lives, DNA may be said to be the key to understanding life itself.... More

Hardback edition
Helpful? Upvote 55

“Creation”

Creation is split into two parts - one discussing the origins of life, the other exploring what lies ahead in biology (written on flip sides "like a double helix" so that either can be read first).

The... More

Paperback edition
Helpful? Upvote 35

“A layperson’s guide to DNA and genetics.”

It starts with a papercut.

The book that is, not the origin of life. Rutherford starts by breaking down exactly what happens when you cut your finger in a jaw-dropping three-page extravaganza of cells, electrical... More

Paperback edition
Helpful? Upvote 24

Please sign in to write a review

Your review has been submitted successfully.